AnsweredAssumed Answered

Break a string in a value list of triplets

Question asked by psijmons on May 27, 2016
Latest reply on May 28, 2016 by CamelCase_data

I'm breaking my head over this but I can't get it to work properly and am sure this wheel has been invented before;

I need to break up a string of DNA sequences into a value list of triplets

 

GGATCCGCCACCATGAACGGCGACGACGCCTTCGCCAGACGGCCTACAGTGGGCGCCCAGATCCCCGAGAAGATCCAGAAGGCCTTCGACGATATC

etc etc,

 

should become:

GGA

TCC

GCC

ACC

etc etc.

 

Anyone with a clever idea for a CustomFunction?

Outcomes